Detail of EST/Unigene TCNT59099 |
Acc. | TCNT59099 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable mannitol dehydrogenase OS=Fragaria ananassa E-value=0; 8-hydroxygeraniol dehydrogenase OS=Catharanthus roseus E-value=0; Probable mannitol dehydrogenase OS=Mesembryanthemum crystallinum E-value=0; Geraniol dehydrogenase 1 OS=Ocimum basilicum E-value=0; Mannitol dehydrogenase OS=Apium graveolens E-value=0; |
Length | 1299 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_AGN_PNL (5 ESTs); LIBEST_024954 (3 ESTs); NT_KL4B (2 ESTs); NT_EST_CSP (1 ESTs); LIBEST_023330 (1 ESTs); NT_CHO_SL (1 ESTs); NT_KT7 (1 ESTs); NT_KR3B (1 ESTs); |
Sequence | ACACTTTACTTCACCATTTTCCATAGTTCCACTACCAATAATAACATTGTCTGAACCACC |
EST members of Unigene | FG179815 FS378000 EB450798 FS434803 FG179242 FG622431 FG179334 FG191858 EH615164 FG191948 EB681503 FS406639 EB684169 EH623013 EB680301 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829955 |
Trichome-related Gene from Literature | 829955 |