Detail of EST/Unigene TCNT60444 |
Acc. | TCNT60444 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=0; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=1e-83; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=2e-82; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=2e-70; Glutathione S-transferase OS=Silene vulgaris E-value=1e-64; |
Length | 1004 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_CHO_SL (14 ESTs); LIBEST_024954 (3 ESTs); NT_EST_CSP (2 ESTs); NT_MAT001 (2 ESTs); NT_MAT005 (1 ESTs); NT_COL (1 ESTs); NT_SL (1 ESTs); MT_CDS (1 ESTs); |
Sequence | ACATTCTCTTTCTAAAACAAAGTTTTCCCCACTATTATTTTTTCTCACTATTCTCTTTCT |
EST members of Unigene | AM816702 EH617486 EH617476 EH617468 BP531753 EH617448 EH614683 EH619194 EH617819 EH617428 FS430572 EH624126 EH617493 FS398749 AJ937852 AM817210 EH621276 FS396708 BP132576 EH614985 BP527318 EH623211 EH621065 EH622593 EH617704 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |