Detail of EST/Unigene TCNT60868 |
Acc. | TCNT60868 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=4e-93; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-87; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-84; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Thioalkalivibrio sp. (strain HL-EbGR7) E-value=4e-41; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Ralstonia metallidurans (strain CH34 / ATCC 43123 / DSM 2839) E-value=5e-41; |
Length | 952 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (14 ESTs); NT_MAT001 (2 ESTs); NT_KL4B (2 ESTs); NT_KP1BS (2 ESTs); NT_NNT (2 ESTs); LIBEST_023330 (1 ESTs); NT_KG9B (1 ESTs); NT_KL5B (1 ESTs); NT_LTRI3 (1 ESTs); NT_TRI_K326 (1 ESTs); |
Sequence | GAGGCACAGACTCCCTTCAATTTTACACAATTTAAAGGTGCTTCTTCTTCTTCTTCTTCT |
EST members of Unigene | FS393123 FS431490 FS392788 DV999190 BP132679 FG636274 CV021341 FS438214 BP133074 FS384137 FS398657 FS401824 FS396821 DV999792 CV016187 FS416153 EB430262 FG641241 FS434851 DV160724 FS435037 EB678955 FS390270 FS409216 FS396669 FG621679 DV160505 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842700 |
Trichome-related Gene from Literature | 842700 |