| Detail of EST/Unigene TCNT61282 |
| Acc. | TCNT61282 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase OS=Hyoscyamus muticus E-value=0; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=1e-82; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=2e-81; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=1e-68; Glutathione S-transferase F2 OS=Arabidopsis thaliana E-value=4e-64; |
| Length | 916 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KR2B (3 ESTs); NT_KR3B (3 ESTs); NT_KL5B (2 ESTs); NT_KT7 (2 ESTs); |
| Sequence | TTCCACGTTTAATTAATCTCTTTCTAACACAAAGTTTTCCTCACTATTATTTTTTCTCAC |
| EST members of Unigene | EB450928 DW002777 DW003366 EB432537 DW004596 EB446245 EB447924 EB443725 EB446496 EB431050 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819386 |
| Trichome-related Gene from Literature | 819386 |