Detail of EST/Unigene TCNT61663 |
Acc. | TCNT61663 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=0; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=0; Glutathione S-transferase OS=Hyoscyamus muticus E-value=7e-86; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=5e-69; Glutathione S-transferase OS=Silene vulgaris E-value=4e-65; |
Length | 890 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | LIBEST_024954 (3 ESTs); NT_KR3B (2 ESTs); NT_KR2B (1 ESTs); MT_CDS (1 ESTs); NT_MAT001 (1 ESTs); NT_DL (1 ESTs); |
Sequence | TCATGTTAAAGCAATATATTTATCACAATCCTAATTGATTATTCTTGATCTTTTAGTTAT |
EST members of Unigene | FS419108 DW001990 FS431801 AM783472 TOBAPI2B EB445817 FS385204 DW004474 BP137435 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |