Detail of EST/Unigene TCNT65459 |
Acc. | TCNT65459 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Metallothionein-like protein type 2 OS=Nicotiana plumbaginifolia E-value=5e-14; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=4e-12; Metallothionein-like protein type 2 A OS=Solanum lycopersicum E-value=1e-11; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=2e-10; Metallothionein-like protein type 2 OS=Solanum lycopersicum E-value=4e-10; |
Length | 528 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_NNT (14 ESTs); NT_CHO_SL (9 ESTs); NT_TL13 (3 ESTs); NT_KN6B (2 ESTs); NT_KR2B (2 ESTs); NT_KP1BS (2 ESTs); NB_BL12 (2 ESTs); NT_KL5B (2 ESTs); NT_KF8 (1 ESTs); NT_KR3B (1 ESTs); LIBEST_024954 (1 ESTs); NT_EITL (1 ESTs); NT_EST_CSP (1 ESTs); NT_K326_ESL (1 ESTs); |
Sequence | CACACAATTTGCTTTAGTGATTAAACTTTCTTTCACACCAAACTAAAGGTTTATTATCTC |
EST members of Unigene | EB445024 EH618061 EH623930 CV016172 CV017337 EB447403 CV016180 EH620817 DV161228 CV017123 EB436436 CV018794 EB442804 CV017062 EH615044 CV016882 CV020377 EB430317 EB442861 EB436631 EH619847 FS398156 CV018369 EB435778 EB428680 EB434029 EH621670 FG641706 CV017812 CV020907 EH620320 DV162049 EH620668 DW001506 CV016011 EH620844 EG650105 CV018337 EH620650 CV016215 EB430206 EB433220 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831816 |
Trichome-related Gene from Literature | 831816 |