Detail of EST/Unigene TCOB40396 |
Acc. | TCOB40396 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=1e-52; Glutathione S-transferase OS=Hyoscyamus muticus E-value=3e-52; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=3e-52; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=8e-51; Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=2e-49; |
Length | 800 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_MEa (4 ESTs); OB_EEa (2 ESTs); |
Sequence | AAGATGCATCACATTATTACAGCACTCAGAACTTCACAAATAAGTGAAGAAGATAGTGTA |
EST members of Unigene | DY329423 DY329422 DY327777 DY327776 DY324650 DY323494 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |