| Detail of EST/Unigene TCSA10803 |
| Acc. | TCSA10803 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=1e-86; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=2e-80; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=3e-80; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=1e-75; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=2e-74; |
| Length | 606 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | |
| Sequence | TATACTGCAGCAATTGATGTATGGTCAGTGGGTTGTATCTTCATGGAGTTGATGGACAGA |
| EST members of Unigene | SRR027943.208953 SRR027943.185523 SRR027943.339984 SRR027943.366291 SRR027943.205094 SRR027943.276545 SRR027943.385555 SRR027943.450432 SRR027943.442987 SRR027943.278449 SRR027943.485702 SRR027943.340256 SRR027943.347925 SRR027943.20391 SRR027943.295115 SRR027943.252003 SRR027943.241946 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
| EC | 2.7.11.24 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818982 |
| Trichome-related Gene from Literature | 818982 |