Detail of EST/Unigene TCSA12054 |
Acc. | TCSA12054 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Pyrophosphate-energized vacuolar membrane proton pump OS=Vigna radiata var. radiata E-value=3e-06; Pyrophosphate-energized vacuolar membrane proton pump 1 OS=Arabidopsis thaliana E-value=3e-06; |
Length | 224 nt |
Species | Solanum arcanum |
Belonged EST Libraries | |
Sequence | ACCATATGCATCAATTGCCAAACCAGTGGCTATAGTGCTCAGCATTCCAAGGGCAGCAAC |
EST members of Unigene | SRR027943.89595 SRR027943.420195 SRR027943.295034 SRR027943.308170 SRR027943.43289 SRR027943.234716 SRR027943.378567 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase |
Probeset |
|
Corresponding NCBI Gene | 838138 |
Trichome-related Gene from Literature | 838138 |