| Detail of EST/Unigene TCSA12054 |
| Acc. | TCSA12054 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Pyrophosphate-energized vacuolar membrane proton pump OS=Vigna radiata var. radiata E-value=3e-06; Pyrophosphate-energized vacuolar membrane proton pump 1 OS=Arabidopsis thaliana E-value=3e-06; |
| Length | 224 nt |
| Species | Solanum arcanum |
| Belonged EST Libraries | |
| Sequence | ACCATATGCATCAATTGCCAAACCAGTGGCTATAGTGCTCAGCATTCCAAGGGCAGCAAC |
| EST members of Unigene | SRR027943.89595 SRR027943.420195 SRR027943.295034 SRR027943.308170 SRR027943.43289 SRR027943.234716 SRR027943.378567 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase |
| Probeset |
|
| Corresponding NCBI Gene | 838138 |
| Trichome-related Gene from Literature | 838138 |