| Detail of EST/Unigene TCSF10750 |
| Acc. | TCSF10750 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Fatty acid 2-hydroxylase OS=Rattus norvegicus E-value=1e-52; Fatty acid 2-hydroxylase OS=Macaca fascicularis E-value=1e-52; Fatty acid 2-hydroxylase OS=Mus musculus E-value=8e-52; Fatty acid 2-hydroxylase OS=Homo sapiens E-value=9e-51; Ceramide very long chain fatty acid hydroxylase SCS7 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-46; |
| Length | 1215 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (58 ESTs); |
| Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTCTTTTTTTTTTGTTGCATGAATC |
| EST members of Unigene | SRR027942.289507 SRR027942.240679 SRR027942.98262 SRR027942.47968 SRR027942.120318 SRR027942.159930 SRR027942.204228 SRR027942.254151 SRR027942.291069 SRR027942.226363 SRR027942.266066 SRR027942.65194 SRR027942.88280 SRR027942.164882 SRR027942.8670 SRR027942.70540 SRR027942.171845 SRR027942.193296 SRR027942.203485 SRR027942.125234 SRR027942.288182 SRR027942.128346 SRR027942.275686 SRR027942.62315 SRR027942.271582 SRR027942.233453 SRR027942.186194 SRR027942.191306 SRR027942.272390 SRR027942.103788 SRR027942.165980 SRR027942.212573 SRR027942.60229 SRR027942.58270 SRR027942.131913 SRR027942.122359 SRR027942.43733 SRR027942.203724 SRR027942.293903 SRR027942.251499 SRR027942.32132 SRR027942.136360 SRR027942.262897 SRR027942.191801 SRR027942.30226 SRR027942.60677 SRR027942.132752 SRR027942.292802 SRR027942.40855 SRR027942.47126 SRR027942.233949 SRR027942.130583 SRR027942.274221 SRR027942.156699 SRR027942.138176 SRR027942.269535 SRR027942.13908 SRR027942.193389 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818042 |
| Trichome-related Gene from Literature | 818042 |