| Detail of EST/Unigene TCSF10758 |
| Acc. | TCSF10758 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=0; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=0; Trans-cinnamate 4-monooxygenase OS=Populus kitakamiensis E-value=0; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=0; Trans-cinnamate 4-monooxygenase OS=Zinnia elegans E-value=0; |
| Length | 1197 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (39 ESTs); |
| Sequence | TGCACCAAACGTCCAATGGTGATGCCAAGAATTGGCAATGCAAGGATAATTCCGGGGCAA |
| EST members of Unigene | SRR027942.178132 SRR027942.213857 SRR027942.48965 SRR027942.35603 SRR027942.67779 SRR027942.16720 SRR027942.109195 SRR027942.232431 SRR027942.215031 SRR027942.44854 SRR027942.46454 SRR027942.140828 SRR027942.220543 SRR027942.206431 SRR027942.17742 SRR027942.297000 SRR027942.108839 SRR027942.240710 SRR027942.124017 SRR027942.205976 SRR027942.14332 SRR027942.281035 SRR027942.106963 SRR027942.81376 SRR027942.138736 SRR027942.180350 SRR027942.119021 SRR027942.93269 SRR027942.218207 SRR027942.161644 SRR027942.127854 SRR027942.77135 SRR027942.54011 SRR027942.217709 SRR027942.149539 SRR027942.39293 SRR027942.6618 SRR027942.289253 SRR027942.136237 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase) |
| EC | 1.14.99.9 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817599 |
| Trichome-related Gene from Literature | 817599 |