Detail of EST/Unigene TCSF10847 |
Acc. | TCSF10847 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Catharanthus roseus E-value=7e-86; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-83; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-82; 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase OS=Ralstonia metallidurans (strain CH34 / ATCC 43123 / DSM 2839) E-value=5e-41; Bifunctional enzyme IspD/IspF OS=Erythrobacter litoralis (strain HTCC2594) E-value=9e-41; |
Length | 1017 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (58 ESTs); |
Sequence | GGAAACATAATTAGTTCGGATATCTAAATAAAATATTGGGACTAGAATGCCACTTGTCTT |
EST members of Unigene | SRR027942.54049 SRR027942.139805 SRR027942.138440 SRR027942.172194 SRR027942.248323 SRR027942.33233 SRR027942.228326 SRR027942.224014 SRR027942.191861 SRR027942.130244 SRR027942.65601 SRR027942.74001 SRR027942.225764 SRR027942.34038 SRR027942.224241 SRR027942.123073 SRR027942.58801 SRR027942.141218 SRR027942.233269 SRR027942.284088 SRR027942.247174 SRR027942.295429 SRR027942.299362 SRR027942.101033 SRR027942.89320 SRR027942.255947 SRR027942.127942 SRR027942.175772 SRR027942.111210 SRR027942.118039 SRR027942.224926 SRR027942.147729 SRR027942.299820 SRR027942.236656 SRR027942.242730 SRR027942.265398 SRR027942.69626 SRR027942.257379 SRR027942.167330 SRR027942.154262 SRR027942.83099 SRR027942.139874 SRR027942.280843 SRR027942.255258 SRR027942.233544 SRR027942.133138 SRR027942.80253 SRR027942.184150 SRR027942.107967 SRR027942.198888 SRR027942.192799 SRR027942.137018 SRR027942.9375 SRR027942.74752 SRR027942.211611 SRR027942.204358 SRR027942.278119 SRR027942.258397 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842700 |
Trichome-related Gene from Literature | 842700 |