| Detail of EST/Unigene TCSF11216 |
| Acc. | TCSF11216 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=3e-30; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Rattus norvegicus E-value=3e-07; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Sus scrofa E-value=3e-07; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Mus musculus E-value=5e-07; Hydroxymethylglutaryl-CoA synthase, mitochondrial OS=Bos taurus E-value=2e-06; |
| Length | 705 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (30 ESTs); |
| Sequence | GAGTGGATTGACTGCAACTATGTTTTCGTCTAAAGTTTAACGAAGGTCAACATCCTTTTA |
| EST members of Unigene | SRR027942.266091 SRR027942.207756 SRR027942.12790 SRR027942.66196 SRR027942.71474 SRR027942.290469 SRR027942.102964 SRR027942.138650 SRR027942.58970 SRR027942.231096 SRR027942.150021 SRR027942.153822 SRR027942.136926 SRR027942.246399 SRR027942.237122 SRR027942.126532 SRR027942.292329 SRR027942.111998 SRR027942.240950 SRR027942.178196 SRR027942.11897 SRR027942.295690 SRR027942.107153 SRR027942.238246 SRR027942.103887 SRR027942.95884 SRR027942.182000 SRR027942.164241 SRR027942.144235 SRR027942.168960 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
| EC | 2.3.3.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826788 |
| Trichome-related Gene from Literature | 826788 |