Detail of EST/Unigene TCSF11357 |
Acc. | TCSF11357 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=2e-50; 3-ketoacyl-CoA synthase 6 OS=Arabidopsis thaliana E-value=1e-45; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=4e-45; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=2e-43; 3-ketoacyl-CoA synthase 5 OS=Arabidopsis thaliana E-value=1e-42; |
Length | 657 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (40 ESTs); |
Sequence | TACGTAAATTTTTGTTTATCACCAATATAAAATATTCATAATACATTTATTTCACAAATT |
EST members of Unigene | SRR027942.212866 SRR027942.25792 SRR027942.111736 SRR027942.294804 SRR027942.224020 SRR027942.99039 SRR027942.255124 SRR027942.261190 SRR027942.62500 SRR027942.197789 SRR027942.76803 SRR027942.102223 SRR027942.189165 SRR027942.78190 SRR027942.244445 SRR027942.275492 SRR027942.65650 SRR027942.184631 SRR027942.237768 SRR027942.231250 SRR027942.269575 SRR027942.108913 SRR027942.100303 SRR027942.165161 SRR027942.264423 SRR027942.180545 SRR027942.278268 SRR027942.118817 SRR027942.171263 SRR027942.222566 SRR027942.136601 SRR027942.80213 SRR027942.70097 SRR027942.167413 SRR027942.214382 SRR027942.183166 SRR027942.267205 SRR027942.63403 SRR027942.24934 SRR027942.150498 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817165 |
Trichome-related Gene from Literature | 817165 |