Detail of EST/Unigene TCSF11486 |
Acc. | TCSF11486 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Solanum lycopersicum E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=0; 15-cis-phytoene desaturase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. japonica E-value=0; Phytoene dehydrogenase, chloroplastic/chromoplastic OS=Oryza sativa subsp. indica E-value=0; |
Length | 607 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (9 ESTs); |
Sequence | AGGATTACCATCTAAAAAGGCCATTTTTGAACCATGTTTCTCCTGAAGAAACCTGTTCAA |
EST members of Unigene | SRR027942.265756 SRR027942.146476 SRR027942.250458 SRR027942.106243 SRR027942.9213 SRR027942.272687 SRR027942.82154 SRR027942.87027 SRR027942.259516 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827061 |
Trichome-related Gene from Literature | 827061 |