Detail of EST/Unigene TCSF11511 |
Acc. | TCSF11511 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-interferon-inducible lysosomal thiol reductase OS=Homo sapiens E-value=3e-21; Gamma-interferon-inducible-lysosomal thiol reductase OS=Sus scrofa E-value=1e-20; Gamma-interferon-inducible lysosomal thiol reductase OS=Bos taurus E-value=5e-20; Gamma-interferon-inducible lysosomal thiol reductase OS=Rattus norvegicus E-value=2e-19; Gamma-interferon-inducible lysosomal thiol reductase OS=Mus musculus E-value=5e-19; |
Length | 601 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (23 ESTs); |
Sequence | AAATAATTAAAGGTAGAAAGAAGAAAGTTCCATAAGGGAAAAATGGCATCTCATAATCAA |
EST members of Unigene | SRR027942.280515 SRR027942.24394 SRR027942.111912 SRR027942.175939 SRR027942.230879 SRR027942.200325 SRR027942.188175 SRR027942.84834 SRR027942.89737 SRR027942.254999 SRR027942.17672 SRR027942.267813 SRR027942.87110 SRR027942.285858 SRR027942.123317 SRR027942.147497 SRR027942.81168 SRR027942.184903 SRR027942.199468 SRR027942.139547 SRR027942.116360 SRR027942.237687 SRR027942.261567 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831721 |
Trichome-related Gene from Literature | 831721 |