| Detail of EST/Unigene TCSF11538 |
| Acc. | TCSF11538 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chalcone synthase J OS=Petunia hybrida E-value=3e-80; Chalcone synthase A OS=Petunia hybrida E-value=4e-80; Chalcone synthase 1B OS=Solanum tuberosum E-value=4e-79; Chalcone synthase 2 OS=Solanum tuberosum E-value=4e-79; Chalcone synthase 1 OS=Camellia sinensis E-value=4e-79; |
| Length | 589 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (20 ESTs); |
| Sequence | CCTATCCTGACTATTTTTTCGTATCACTAATAGTGAACATAAGAGTGAACTTAAACGAAA |
| EST members of Unigene | SRR027942.184377 SRR027942.217731 SRR027942.297932 SRR027942.147227 SRR027942.131427 SRR027942.119938 SRR027942.17134 SRR027942.220713 SRR027942.64494 SRR027942.183783 SRR027942.121067 SRR027942.210173 SRR027942.106331 SRR027942.158816 SRR027942.81147 SRR027942.286857 SRR027942.204911 SRR027942.109492 SRR027942.121604 SRR027942.238832 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831241 |
| Trichome-related Gene from Literature | 831241 |