| Detail of EST/Unigene TCSF11660 |
| Acc. | TCSF11660 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=4e-38; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=4e-35; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=4e-31; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-30; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=3e-30; |
| Length | 541 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (13 ESTs); |
| Sequence | TTTTTTTTTGGTCAGCCAATAGATTCATTTATTACTTTAGCATTGCTATGTTACTTTTCT |
| EST members of Unigene | SRR027942.96851 SRR027942.13943 SRR027942.269776 SRR027942.79922 SRR027942.42502 SRR027942.85721 SRR027942.257425 SRR027942.37486 SRR027942.271643 SRR027942.103417 SRR027942.98924 SRR027942.91308 SRR027942.105354 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828409 |
| Trichome-related Gene from Literature | 828409 |