Detail of EST/Unigene TCSF11833 |
Acc. | TCSF11833 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase/oxygenase activase, chloroplastic OS=Solanum pennellii E-value=2e-73; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Nicotiana tabacum E-value=2e-58; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Nicotiana tabacum E-value=3e-58; Ribulose bisphosphate carboxylase/oxygenase activase 2, chloroplastic OS=Larrea tridentata E-value=3e-43; Ribulose bisphosphate carboxylase/oxygenase activase 1, chloroplastic OS=Larrea tridentata E-value=3e-43; |
Length | 491 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (11 ESTs); |
Sequence | TTTGTCCATGAAAGCAGGAGCAATGTAGAAACCGTCCAATTTGTTGTCCAATTGGTACGT |
EST members of Unigene | SRR027942.247743 SRR027942.277018 SRR027942.136295 SRR027942.232771 SRR027942.220227 SRR027942.130763 SRR027942.89985 SRR027942.56502 SRR027942.201008 SRR027942.22923 SRR027942.84853 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818558 |
Trichome-related Gene from Literature | 818558 |