Detail of EST/Unigene TCSF12023 |
Acc. | TCSF12023 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter C family member 5 OS=Arabidopsis thaliana E-value=5e-11; |
Length | 443 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (8 ESTs); |
Sequence | TGGTCGGGTGGCTGAGTTTGATACTCCAGCACGACTCTTAGAGGACAAATCTTCTATGTT |
EST members of Unigene | SRR027942.294046 SRR027942.294591 SRR027942.241634 SRR027942.225969 SRR027942.283030 SRR027942.267978 SRR027942.232749 SRR027942.29810 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
Probeset |
|
Corresponding NCBI Gene | 839277 |
Trichome-related Gene from Literature | 839277 |