| Detail of EST/Unigene TCSF12023 |
| Acc. | TCSF12023 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter C family member 5 OS=Arabidopsis thaliana E-value=5e-11; |
| Length | 443 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (8 ESTs); |
| Sequence | TGGTCGGGTGGCTGAGTTTGATACTCCAGCACGACTCTTAGAGGACAAATCTTCTATGTT |
| EST members of Unigene | SRR027942.294046 SRR027942.294591 SRR027942.241634 SRR027942.225969 SRR027942.283030 SRR027942.267978 SRR027942.232749 SRR027942.29810 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
| Probeset |
|
| Corresponding NCBI Gene | 839277 |
| Trichome-related Gene from Literature | 839277 |