| Detail of EST/Unigene TCSF12124 |
| Acc. | TCSF12124 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=1e-16; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=1e-15; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=2e-15; Farnesyl pyrophosphate synthase 1 OS=Parthenium argentatum E-value=4e-15; Farnesyl pyrophosphate synthase 2 OS=Arabidopsis thaliana E-value=5e-15; |
| Length | 424 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (28 ESTs); |
| Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTCTTTTTTTTTTCCAAAGCAGAAT |
| EST members of Unigene | SRR027942.238902 SRR027942.125947 SRR027942.94521 SRR027942.88469 SRR027942.94503 SRR027942.179882 SRR027942.72871 SRR027942.249490 SRR027942.249108 SRR027942.90680 SRR027942.270028 SRR027942.48990 SRR027942.60765 SRR027942.211425 SRR027942.218078 SRR027942.55086 SRR027942.264008 SRR027942.11088 SRR027942.252100 SRR027942.60994 SRR027942.15045 SRR027942.55703 SRR027942.63759 SRR027942.62971 SRR027942.125299 SRR027942.128807 SRR027942.80403 SRR027942.56903 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
| EC | 2.5.1.1 2.5.1.10 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827430 |
| Trichome-related Gene from Literature | 827430 |