| Detail of EST/Unigene TCSF12150 |
| Acc. | TCSF12150 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase subunit C OS=Arabidopsis thaliana E-value=1e-15; |
| Length | 417 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (11 ESTs); |
| Sequence | CCCTCAATCAAAAGTGAGAAGAAAGTACGTTCCATTCTCGAGTCACTCTGCGACAGTTCA |
| EST members of Unigene | SRR027942.268622 SRR027942.47946 SRR027942.195583 SRR027942.84148 SRR027942.171730 SRR027942.80215 SRR027942.215712 SRR027942.108335 SRR027942.77658 SRR027942.188232 SRR027942.213732 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
| Probeset |
|
| Corresponding NCBI Gene | 837840 |
| Trichome-related Gene from Literature | 837840 |