Detail of EST/Unigene TCSF12150 |
Acc. | TCSF12150 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | V-type proton ATPase subunit C OS=Arabidopsis thaliana E-value=1e-15; |
Length | 417 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (11 ESTs); |
Sequence | CCCTCAATCAAAAGTGAGAAGAAAGTACGTTCCATTCTCGAGTCACTCTGCGACAGTTCA |
EST members of Unigene | SRR027942.268622 SRR027942.47946 SRR027942.195583 SRR027942.84148 SRR027942.171730 SRR027942.80215 SRR027942.215712 SRR027942.108335 SRR027942.77658 SRR027942.188232 SRR027942.213732 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.2 H+- or Na+-translocating F-type, V-type and A-type ATPase superfamily F-ATPase |
Probeset |
|
Corresponding NCBI Gene | 837840 |
Trichome-related Gene from Literature | 837840 |