Detail of EST/Unigene TCSF12154 |
Acc. | TCSF12154 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=3e-10; |
Length | 416 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (15 ESTs); |
Sequence | TAGAGACCGAGGCGGCCGACATGTTTGTTTTTTTCTTTTTTTTTCGGCAATTTGGATCCT |
EST members of Unigene | SRR027942.189123 SRR027942.66996 SRR027942.237162 SRR027942.227400 SRR027942.154630 SRR027942.29169 SRR027942.163103 SRR027942.138015 SRR027942.170751 SRR027942.226833 SRR027942.170275 SRR027942.29398 SRR027942.252106 SRR027942.263871 SRR027942.240810 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |