| Detail of EST/Unigene TCSF12409 |
| Acc. | TCSF12409 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Actin OS=Gossypium hirsutum E-value=1e-32; Actin-7 OS=Arabidopsis thaliana E-value=1e-32; Actin-4 OS=Arabidopsis thaliana E-value=1e-32; Actin-3 OS=Oryza sativa subsp. japonica E-value=1e-32; Actin-3 OS=Oryza sativa subsp. indica E-value=1e-32; |
| Length | 372 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (17 ESTs); |
| Sequence | CTCAATTGGGTATTTAAGAGTTAAAATACCTCTCTTCGATTGAGCTTTCATCTCCCACAT |
| EST members of Unigene | SRR027942.240636 SRR027942.23380 SRR027942.295543 SRR027942.86142 SRR027942.274667 SRR027942.210901 SRR027942.246210 SRR027942.140145 SRR027942.162647 SRR027942.286712 SRR027942.29187 SRR027942.87414 SRR027942.162193 SRR027942.162796 SRR027942.87044 SRR027942.127830 SRR027942.256429 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836056 |
| Trichome-related Gene from Literature | 836056 |