| Detail of EST/Unigene TCSF12503 |
| Acc. | TCSF12503 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter G family member 12 OS=Arabidopsis thaliana E-value=2e-36; ABC transporter G family member 15 OS=Arabidopsis thaliana E-value=4e-36; ABC transporter G family member 13 OS=Arabidopsis thaliana E-value=3e-31; ABC transporter G family member 11 OS=Arabidopsis thaliana E-value=2e-25; ABC transporter G family member 3 OS=Arabidopsis thaliana E-value=8e-11; |
| Length | 353 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (10 ESTs); |
| Sequence | CCTCACTGGAACCATTACCTATTACATGGTGTTTCGGGCTAGATTCTTCCGTTATGTGTT |
| EST members of Unigene | SRR027942.47426 SRR027942.283309 SRR027942.249116 SRR027942.221306 SRR027942.40525 SRR027942.98606 SRR027942.237684 SRR027942.178018 SRR027942.274183 SRR027942.40404 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
| Probeset |
|
| Corresponding NCBI Gene | 841575 |
| Trichome-related Gene from Literature | 841575 |