Detail of EST/Unigene TCSF12889 |
Acc. | TCSF12889 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=8e-12; |
Length | 282 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (9 ESTs); |
Sequence | AAGAAACACAAATTCACCCATTTTGTGAAAACATTACTGAAATTATAATTACAAACAACA |
EST members of Unigene | SRR027942.244640 SRR027942.194087 SRR027942.224450 SRR027942.138266 SRR027942.126375 SRR027942.146621 SRR027942.117757 SRR027942.144997 SRR027942.117669 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834273 |
Trichome-related Gene from Literature | 834273 |