| Detail of EST/Unigene TCSF12889 |
| Acc. | TCSF12889 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide synthase, chloroplastic OS=Arabidopsis thaliana E-value=8e-12; |
| Length | 282 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (9 ESTs); |
| Sequence | AAGAAACACAAATTCACCCATTTTGTGAAAACATTACTGAAATTATAATTACAAACAACA |
| EST members of Unigene | SRR027942.244640 SRR027942.194087 SRR027942.224450 SRR027942.138266 SRR027942.126375 SRR027942.146621 SRR027942.117757 SRR027942.144997 SRR027942.117669 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834273 |
| Trichome-related Gene from Literature | 834273 |