| Detail of EST/Unigene TCSF13038 |
| Acc. | TCSF13038 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=7e-09; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=4e-08; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=4e-07; |
| Length | 254 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (12 ESTs); |
| Sequence | GATCAATACACGCTTTCTCTCTCTAAAAAATCTTTTACGTTTCTCACTCTCTGTGAGAAA |
| EST members of Unigene | SRR027942.188782 SRR027942.68027 SRR027942.35643 SRR027942.15371 SRR027942.284619 SRR027942.211454 SRR027942.160695 SRR027942.20209 SRR027942.265443 SRR027942.198081 SRR027942.251156 SRR027942.276733 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844193 |
| Trichome-related Gene from Literature | 844193 |