Detail of EST/Unigene TCSF13250 |
Acc. | TCSF13250 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | MADS-box protein SOC1 OS=Arabidopsis thaliana E-value=5e-08; Agamous-like MADS-box protein AGL14 OS=Arabidopsis thaliana E-value=4e-07; |
Length | 199 nt |
Species | Solanum pimpinellifolium |
Belonged EST Libraries | SRR027942 (10 ESTs); |
Sequence | CCTCAGCATCATATTTTCAGCTGTAAGGGCTCTCTCCCTTTCTTTCAATCTTTCCATTTG |
EST members of Unigene | SRR027942.195645 SRR027942.176369 SRR027942.188352 SRR027942.188726 SRR027942.47770 SRR027942.46544 SRR027942.66934 SRR027942.47900 SRR027942.77682 SRR027942.196123 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | MIKC |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819174 |
Trichome-related Gene from Literature | 819174 |