| Detail of EST/Unigene TCSH50522 |
| Acc. | TCSH50522 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Heat shock cognate 70 kDa protein OS=Petunia hybrida E-value=5e-89; Heat shock cognate 70 kDa protein 2 OS=Solanum lycopersicum E-value=5e-89; Probable mediator of RNA polymerase II transcription subunit 37e OS=Arabidopsis thaliana E-value=1e-88; Probable mediator of RNA polymerase II transcription subunit 37c OS=Arabidopsis thaliana E-value=1e-88; Heat shock cognate 70 kDa protein 1 OS=Solanum lycopersicum E-value=3e-88; |
| Length | 504 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (2 ESTs); SRR027940 (1 ESTs); |
| Sequence | AAGAATGCTGTGGTTACTGTTCCAGCCTACTTTAATGACTCTCAACGTCAGGCCACCAAG |
| EST members of Unigene | SRR027940.74112 SRR027941.278946 SRR027941.184078 SRR027941.17239 SRR027941.260304 SRR027940.91895 SRR027941.52003 SRR027941.281395 SRR027940.45152 SRR027941.22907 SRR027941.319644 SRR027941.301500 SRR027941.320178 SRR027941.15173 SRR027941.193822 SRR027941.299370 SRR027940.91192 SRR027940.57188 SRR027941.25169 AW617489 SRR027940.93155 SRR027941.279669 SRR027941.25196 SRR027941.164615 SRR027941.24417 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03283 heat shock 70kDa protein 1/8 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.3 Ryanodine-inositol-1,4,5-trisphosphate receptor Ca2+ channel RIR-CaC; 1.A.33 Cation-channel-forming heat-shock protein 70 Hsp70 |
| Probeset |
|
| Corresponding NCBI Gene | 831020 |
| Trichome-related Gene from Literature | 831020 |