| Detail of EST/Unigene TCSH51091 |
| Acc. | TCSH51091 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta(24)-sterol reductase OS=Pisum sativum E-value=1e-97; Delta(24)-sterol reductase OS=Arabidopsis thaliana E-value=2e-94; Diminuto-like protein OS=Caenorhabditis elegans E-value=3e-70; Delta(24)-sterol reductase OS=Homo sapiens E-value=3e-42; Delta(24)-sterol reductase OS=Macaca fascicularis E-value=3e-42; |
| Length | 1181 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940 (4 ESTs); SRR027941 (1 ESTs); SH_TRI (1 ESTs); |
| Sequence | TTCCTTCTTTCGTTCCGATGGATCATTGTCATCTTTTTTGTCCTTCCATTCTCGTTCTTG |
| EST members of Unigene | SRR027941.262528 SRR027941.187906 SRR027940.27736 SRR027940.54774 SRR027940.26961 SRR027941.42720 SRR027941.242139 SRR027941.178074 SRR027941.312461 SRR027940.30661 SRR027940.85144 SRR027941.259335 SRR027941.279801 SRR027940.91941 SRR027941.287673 SRR027941.53962 SRR027941.143135 SRR027940.108561 SRR027941.170278 SRR027940.109350 SRR027941.272342 SRR027941.53692 SRR027941.115739 SRR027941.71295 SRR027941.27214 SRR027940.66347 SRR027941.93621 SRR027941.57996 AW616272 SRR027941.309951 SRR027941.67868 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K09828 delta24-sterol reductase |
| EC | 1.3.1.- 1.3.1.72 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821519 |
| Trichome-related Gene from Literature | 821519 |