Detail of EST/Unigene TCSH51092 |
Acc. | TCSH51092 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Delta(24)-sterol reductase OS=Arabidopsis thaliana E-value=1e-84; Delta(24)-sterol reductase OS=Pisum sativum E-value=1e-81; Diminuto-like protein OS=Caenorhabditis elegans E-value=6e-62; Delta(24)-sterol reductase OS=Homo sapiens E-value=2e-34; Delta(24)-sterol reductase OS=Rattus norvegicus E-value=8e-34; |
Length | 887 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941 (1 ESTs); |
Sequence | GTTCTTAGCATTGACACGGAGCGAATGATTGCTAAAGTCGAGCCTCTAGTCAATATGGGA |
EST members of Unigene | SRR027941.287673 SRR027941.42720 SRR027940.26961 SRR027941.187906 SRR027941.262528 SRR027941.242139 SRR027941.178074 SRR027941.312461 SRR027940.30661 SRR027940.85144 SRR027941.259335 SRR027941.279801 SRR027941.53962 SRR027941.143135 SRR027940.108561 SRR027941.170278 SRR027940.109350 SRR027941.272342 SRR027941.115739 SRR027941.71295 SRR027941.112084 SRR027941.27214 SRR027941.67868 SRR027941.309951 SRR027941.57996 SRR027941.93621 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K09828 delta24-sterol reductase |
EC | 1.3.1.- 1.3.1.72 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821519 |
Trichome-related Gene from Literature | 821519 |