| Detail of EST/Unigene TCSH51287 |
| Acc. | TCSH51287 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Pyrophosphate-energized vacuolar membrane proton pump OS=Vigna radiata var. radiata E-value=0; Pyrophosphate-energized vacuolar membrane proton pump 1 OS=Arabidopsis thaliana E-value=0; Pyrophosphate-energized vacuolar membrane proton pump OS=Hordeum vulgare E-value=0; Putative K(+)-stimulated pyrophosphate-energized sodium pump OS=Leptospira interrogans serogroup Icterohaemorrhagiae serovar Lai (strain 56601) E-value=7e-94; Putative K(+)-stimulated pyrophosphate-energized sodium pump OS=Leptospira interrogans serogroup Icterohaemorrhagiae serovar copenhageni (strain Fiocruz L1-130) E-value=7e-94; |
| Length | 1117 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940 (28 ESTs); SRR027941 (7 ESTs); |
| Sequence | ATGGTCCCATTAGTGATAATGCAGGAGGATTGCTGAGATGGCTGGAATGAGCCACAGAAT |
| EST members of Unigene | SRR027940.111571 SRR027941.189099 SRR027940.126625 SRR027940.107892 SRR027940.82398 SRR027940.90507 SRR027940.93982 SRR027940.34669 SRR027940.117341 SRR027940.125449 SRR027941.278309 SRR027940.77387 SRR027941.301509 SRR027941.174236 SRR027941.263786 SRR027941.148103 SRR027940.19095 SRR027941.111777 SRR027941.234495 SRR027941.33118 SRR027940.21968 SRR027940.28920 SRR027941.66946 SRR027940.9592 SRR027940.127659 SRR027941.62458 SRR027941.282094 SRR027940.69581 SRR027941.64016 SRR027940.99521 SRR027940.87531 SRR027940.16825 SRR027940.56418 SRR027940.55252 SRR027941.57917 SRR027941.237965 SRR027940.60266 SRR027941.189423 SRR027940.27089 SRR027941.85501 SRR027941.182838 SRR027940.70984 SRR027940.49327 SRR027940.89323 SRR027941.28031 SRR027940.112874 SRR027940.90473 SRR027941.205187 SRR027940.76170 SRR027940.69406 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea); 3.A.10 H+-translocating diphosphatase H+-PPase |
| Probeset |
|
| Corresponding NCBI Gene | 838138 |
| Trichome-related Gene from Literature | 838138 |