Detail of EST/Unigene TCSH51350 |
Acc. | TCSH51350 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Delta(24)-sterol reductase OS=Pisum sativum E-value=4e-09; |
Length | 262 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | |
Sequence | GAGATCAAGCTCATTCCGATCAAGGAATACATGAAACTTACCTACAAACCTGTAGTTGGT |
EST members of Unigene | SRR027941.96279 SRR027941.304736 SRR027941.74198 SRR027941.139326 SRR027941.326143 SRR027941.64377 SRR027941.113955 SRR027940.96658 SRR027941.16315 GT183799 SRR027941.137799 SRR027941.22588 GT183760 SRR027940.110173 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821519 |
Trichome-related Gene from Literature | 821519 |