| Detail of EST/Unigene TCSH51350 |
| Acc. | TCSH51350 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Delta(24)-sterol reductase OS=Pisum sativum E-value=4e-09; |
| Length | 262 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | |
| Sequence | GAGATCAAGCTCATTCCGATCAAGGAATACATGAAACTTACCTACAAACCTGTAGTTGGT |
| EST members of Unigene | SRR027941.96279 SRR027941.304736 SRR027941.74198 SRR027941.139326 SRR027941.326143 SRR027941.64377 SRR027941.113955 SRR027940.96658 SRR027941.16315 GT183799 SRR027941.137799 SRR027941.22588 GT183760 SRR027940.110173 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821519 |
| Trichome-related Gene from Literature | 821519 |