| Detail of EST/Unigene TCSH51839 |
| Acc. | TCSH51839 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Oryza sativa subsp. japonica E-value=0; Cysteine synthase OS=Triticum aestivum E-value=0; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=0; Cysteine synthase OS=Zea mays E-value=0; Bifunctional L-3-cyanoalanine synthase/cysteine synthase 1, mitochondrial OS=Solanum tuberosum E-value=5e-94; |
| Length | 1308 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (19 ESTs); SRR027940 (18 ESTs); LIBEST_025268 (5 ESTs); SH_TRI (1 ESTs); |
| Sequence | TTTTTTTCTTTTTTTTTTCTAACAAGAAGCAACAGCTCTATAAATTTCAAATGTTGTAGA |
| EST members of Unigene | SRR027940.42636 SRR027940.23710 SRR027941.193559 GT170112 SRR027941.246791 SRR027941.118050 SRR027941.163058 SRR027941.291764 SRR027941.134843 SRR027940.6511 SRR027940.63705 SRR027940.12938 SRR027940.19115 GT179369 SRR027940.119748 SRR027940.82477 SRR027940.96369 AW617359 SRR027941.192378 SRR027941.121321 SRR027940.108870 SRR027941.217308 SRR027940.87619 SRR027940.7206 SRR027940.40042 SRR027941.134179 GT179308 SRR027940.38480 SRR027940.85236 SRR027941.171286 SRR027941.19717 SRR027940.28203 SRR027940.76762 SRR027941.92180 SRR027941.77647 GT170155 SRR027941.144347 SRR027941.303310 SRR027941.1930 SRR027941.81283 SRR027940.99771 GT176918 SRR027941.131173 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827145 |
| Trichome-related Gene from Literature | 827145 |