| Detail of EST/Unigene TCSH51938 |
| Acc. | TCSH51938 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter G family member 12 OS=Arabidopsis thaliana E-value=0; ABC transporter G family member 15 OS=Arabidopsis thaliana E-value=0; ABC transporter G family member 13 OS=Arabidopsis thaliana E-value=2e-88; ABC transporter G family member 11 OS=Arabidopsis thaliana E-value=2e-78; ABC transporter G family member 3 OS=Arabidopsis thaliana E-value=4e-33; |
| Length | 1181 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (31 ESTs); SRR027940 (8 ESTs); |
| Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTTCTTTTTTTTTTGGGTTAAACAA |
| EST members of Unigene | SRR027941.152315 SRR027940.19463 SRR027941.189533 SRR027941.109726 SRR027941.293010 SRR027941.165306 SRR027941.169188 SRR027940.78370 SRR027941.268006 SRR027940.126682 SRR027941.72867 SRR027941.11684 SRR027941.279611 SRR027941.150725 SRR027941.197025 SRR027941.152947 SRR027941.2011 SRR027941.57484 SRR027941.211510 SRR027941.2566 SRR027941.106853 SRR027940.28446 SRR027940.110721 SRR027941.93161 SRR027941.66631 SRR027941.300589 SRR027941.52680 SRR027941.298559 SRR027941.257772 SRR027941.137211 SRR027941.200942 SRR027941.245370 SRR027941.281164 SRR027940.1064 SRR027941.88787 SRR027940.99593 SRR027941.119033 SRR027940.36003 SRR027941.141687 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05681 ATP-binding cassette, subfamily G (WHITE), member 2 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
| Probeset |
|
| Corresponding NCBI Gene | 841575 |
| Trichome-related Gene from Literature | 841575 |