| Detail of EST/Unigene TCSH52266 |
| Acc. | TCSH52266 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 967 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (28 ESTs); SRR027940 (8 ESTs); SH_TRI (1 ESTs); |
| Sequence | TAGAGACCGAGGCGGCCGACATGTTTTGTTTTTTTTTCTTTTTTTTTTGTAAGATGAAAT |
| EST members of Unigene | SRR027941.26472 SRR027940.81441 SRR027941.54178 SRR027941.32677 SRR027941.58024 SRR027941.240892 SRR027941.267938 SRR027941.282590 SRR027941.112778 SRR027941.138907 SRR027941.66148 SRR027940.54422 SRR027941.52415 SRR027940.26825 SRR027941.128021 SRR027941.226659 SRR027940.20464 AW617631 SRR027941.253202 SRR027941.195315 SRR027940.96396 SRR027941.270910 SRR027940.3667 SRR027941.220443 SRR027941.167430 SRR027941.267052 SRR027941.34612 SRR027941.127476 SRR027941.93377 SRR027941.92159 SRR027941.282147 SRR027941.124687 SRR027941.23431 SRR027940.109410 SRR027940.129678 SRR027941.78426 SRR027941.185435 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839870 |
| Trichome-related Gene from Literature | 839870 |