Detail of EST/Unigene TCSH53009 |
Acc. | TCSH53009 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Actin-depolymerizing factor 2 OS=Petunia hybrida E-value=9e-45; Actin-depolymerizing factor 1 OS=Petunia hybrida E-value=9e-44; Actin-depolymerizing factor 1 OS=Arabidopsis thaliana E-value=8e-43; Actin-depolymerizing factor 4 OS=Arabidopsis thaliana E-value=1e-42; Actin-depolymerizing factor 3 OS=Arabidopsis thaliana E-value=2e-42; |
Length | 665 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940 (17 ESTs); SRR027941 (6 ESTs); |
Sequence | AAGAATCGAGGAAAAGACAAATCATTGTGGAAAAGCTTGGTGAGCCAGCTGAAAGTTATG |
EST members of Unigene | SRR027940.39320 SRR027940.71209 SRR027940.77008 SRR027941.216111 SRR027941.32915 SRR027940.96923 SRR027941.31520 SRR027941.109348 SRR027941.195608 SRR027940.115117 SRR027941.27875 SRR027940.21352 SRR027940.95717 SRR027940.98905 SRR027940.112227 SRR027940.122847 SRR027940.109149 SRR027940.63582 SRR027940.23983 SRR027940.95500 SRR027940.104767 SRR027940.97434 SRR027940.51856 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823744 |
Trichome-related Gene from Literature | 823744 |