| Detail of EST/Unigene TCSH54047 |
| Acc. | TCSH54047 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=8e-51; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=5e-50; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-49; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=2e-49; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-49; |
| Length | 379 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (51 ESTs); |
| Sequence | CATAGCCCATCTGCAATGAATAACCTCCAACTCACGATTCTTAGCGAATGTTTCAGGGTC |
| EST members of Unigene | SRR027941.5196 SRR027941.126563 SRR027941.258724 SRR027941.32724 SRR027941.285468 SRR027941.83729 SRR027941.96104 SRR027941.97716 SRR027941.179270 SRR027941.49159 SRR027941.249395 SRR027941.29324 SRR027941.2804 SRR027941.36181 SRR027941.135121 SRR027941.132497 SRR027941.241585 SRR027941.135114 SRR027941.41580 SRR027941.1605 SRR027941.253491 SRR027941.70411 SRR027941.17886 SRR027941.296692 SRR027941.125535 SRR027941.35297 SRR027941.298973 SRR027941.232176 SRR027941.29421 SRR027941.280482 SRR027941.326049 SRR027941.162360 SRR027941.64626 SRR027941.275215 SRR027941.67841 SRR027941.89314 SRR027941.307058 SRR027941.96233 SRR027941.63439 SRR027941.75369 SRR027941.179851 SRR027941.105616 SRR027941.170182 SRR027941.124907 SRR027941.93439 SRR027941.235044 SRR027941.2129 SRR027941.212857 SRR027941.268941 SRR027941.4922 SRR027941.41882 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |