| Detail of EST/Unigene TCSH54357 |
| Acc. | TCSH54357 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Late embryogenesis abundant protein Lea5 OS=Citrus sinensis E-value=3e-08; Late embryogenesis abundant protein Lea5-D OS=Gossypium hirsutum E-value=8e-08; Late embryogenesis abundant protein Lea5-A OS=Gossypium hirsutum E-value=3e-07; |
| Length | 322 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027940 (7 ESTs); SRR027941 (6 ESTs); |
| Sequence | TCTGGTAGTGTAAGAAGGTAGTGGGGGTGTTAGAAGCAATGTGATGGAATCAAACAAGAC |
| EST members of Unigene | SRR027941.222142 SRR027941.175830 SRR027940.78966 SRR027940.42465 SRR027941.275351 SRR027941.241494 SRR027940.76187 SRR027940.51056 SRR027941.263801 SRR027940.29368 SRR027940.56233 SRR027941.53324 SRR027940.37148 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828053 |
| Trichome-related Gene from Literature | 828053 |