Detail of EST/Unigene TCSH54357 |
Acc. | TCSH54357 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Late embryogenesis abundant protein Lea5 OS=Citrus sinensis E-value=3e-08; Late embryogenesis abundant protein Lea5-D OS=Gossypium hirsutum E-value=8e-08; Late embryogenesis abundant protein Lea5-A OS=Gossypium hirsutum E-value=3e-07; |
Length | 322 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027940 (7 ESTs); SRR027941 (6 ESTs); |
Sequence | TCTGGTAGTGTAAGAAGGTAGTGGGGGTGTTAGAAGCAATGTGATGGAATCAAACAAGAC |
EST members of Unigene | SRR027941.222142 SRR027941.175830 SRR027940.78966 SRR027940.42465 SRR027941.275351 SRR027941.241494 SRR027940.76187 SRR027940.51056 SRR027941.263801 SRR027940.29368 SRR027940.56233 SRR027941.53324 SRR027940.37148 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828053 |
Trichome-related Gene from Literature | 828053 |