| Detail of EST/Unigene TCSH55557 |
| Acc. | TCSH55557 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribulose bisphosphate carboxylase small chain 3B, chloroplastic OS=Solanum lycopersicum E-value=2e-18; Ribulose bisphosphate carboxylase small chain 3A/3C, chloroplastic OS=Solanum lycopersicum E-value=2e-18; Ribulose bisphosphate carboxylase small chain 2A, chloroplastic OS=Solanum lycopersicum E-value=2e-18; Ribulose bisphosphate carboxylase small chain 1, chloroplastic OS=Solanum lycopersicum E-value=2e-18; Ribulose bisphosphate carboxylase small chain 2C, chloroplastic OS=Solanum tuberosum E-value=7e-18; |
| Length | 128 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (4 ESTs); SRR027940 (2 ESTs); |
| Sequence | ATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACACTCTCATACCTTCCTGAT |
| EST members of Unigene | SRR027940.93682 SRR027940.32214 SRR027941.203394 SRR027941.111659 SRR027941.143065 SRR027941.94771 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843029 |
| Trichome-related Gene from Literature | 843029 |