| Detail of EST/Unigene TCSH55628 |
| Acc. | TCSH55628 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Dehydration-responsive protein RD22 OS=Arabidopsis thaliana E-value=3e-06; |
| Length | 100 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (6 ESTs); SRR027940 (4 ESTs); |
| Sequence | ATTATGAAGCAGACAGTAACAGAATGTGAAGAGCCAGGTATTAAAGGAGAGGAGAAGTAT |
| EST members of Unigene | SRR027941.10838 SRR027940.4180 SRR027941.108891 SRR027941.269567 SRR027940.77550 SRR027940.56279 SRR027941.74144 SRR027941.209399 SRR027940.50642 SRR027941.310097 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832636 |
| Trichome-related Gene from Literature | 832636 |