| Detail of EST/Unigene TCSL70127 |
| Acc. | TCSL70127 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Copper transporter 1 OS=Arabidopsis thaliana E-value=3e-25; Copper transporter 6 OS=Arabidopsis thaliana E-value=5e-24; Copper transporter 2 OS=Arabidopsis thaliana E-value=4e-23; Copper transporter 3 OS=Arabidopsis thaliana E-value=1e-21; Copper transporter 4 OS=Arabidopsis thaliana E-value=1e-18; |
| Length | 925 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (14 ESTs); SRR015436 (8 ESTs); SL_MicroLEAF3 (1 ESTs); SL_MicroFRUIT (1 ESTs); SL_SUS_LEAF (1 ESTs); |
| Sequence | CGGCCGGGGACACATTTCACACTCCAATTTAGAAGAAAATTCAACAGAGAGACGATTCAA |
| EST members of Unigene | SRR015435.113026 SRR015435.310188 DB715265 SRR015435.223353 SRR015435.286558 SRR015435.204910 SRR015435.330963 DB705904 SRR015436.317345 SRR015436.82423 SRR015436.201277 SRR015436.3949 SRR015436.13445 SRR015435.53332 SRR015435.214297 SRR015435.304651 SRR015436.11785 SRR015435.100937 SRR015435.85633 SRR015436.54321 AI484249 SRR015435.104638 SRR015435.356461 SRR015435.51374 SRR015436.167448 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 1.A.5 Polycystin cation channel PCC |
| Probeset |
|
| Corresponding NCBI Gene | 836020 |
| Trichome-related Gene from Literature | 836020 |