Detail of EST/Unigene TCSL71929 |
Acc. | TCSL71929 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Protein WAX2 OS=Arabidopsis thaliana E-value=4e-99; |
Length | 1856 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_flower_buds3 (8 ESTs); SL_breaker_fruit (7 ESTs); SL_FRUIT (4 ESTs); SL_FLOWER (4 ESTs); SL_FLOWERBUDS3 (3 ESTs); SL_FLOWERBUDS (2 ESTs); SL_flower_anthesis (2 ESTs); SL_flowerbuds4 (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_maturing_fruit (1 ESTs); SL_flower_buds8 (1 ESTs); |
Sequence | AAAAGCTTAATTTGCTTAAGGATGGCTTCTAAACCTGGCATTCTCACTGAATGGCCTTGG |
EST members of Unigene | BF113020 BM535858 BI935688 BI930266 BI923790 AW929049 AI898468 BM535116 BE436561 BM413053 BI932054 SRR015436.314174 AI771719 BE431764 AI487227 BE432795 BI924522 BI924333 BM412387 BM536202 BE353908 AI486431 BE435059 SRR015436.42238 BE354862 BM410282 AW929907 BI925134 BP895353 AI898888 AI487772 BE354254 BF112653 BI925452 AW428983 BF112463 BE437034 BF112666 SRR015436.26309 BF113453 BE433469 BP885582 AI484061 SRR015436.124890 BI926783 BI923695 AW624020 BE432897 BM411520 BI932073 BI931692 BM409415 AW033623 BI923684 BE353846 BE435577 BI933647 BF112921 BE436414 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837602 |
Trichome-related Gene from Literature | 837602 |