| Detail of EST/Unigene TCSL72403 |
| Acc. | TCSL72403 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ras-related protein RHN1 OS=Nicotiana plumbaginifolia E-value=2e-90; Ras-related protein Rab5 OS=Nicotiana tabacum E-value=1e-88; Ras-related protein RABF2a OS=Arabidopsis thaliana E-value=1e-75; Ras-related protein RABF2b OS=Arabidopsis thaliana E-value=4e-75; Ras-related protein Rab-5C OS=Bos taurus E-value=2e-60; |
| Length | 1033 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (10 ESTs); SRR015436 (1 ESTs); |
| Sequence | GAATGGACAAGAGAAGAAATCCTTTGGTTTTTAGCTTTTGAGGCCTTCCAACATACGTCA |
| EST members of Unigene | SRR015436.305053 AI487413 SRR015435.195994 ES893494 BE458369 BT012776 SRR015435.225707 AW932420 SRR015435.3467 SRR015435.238548 BF051905 AW040276 DB697451 DB682816 SRR015436.48733 SRR015435.267246 SRR015436.110878 FS205842 BI207097 SRR015435.141217 SRR015435.49770 SRR015436.218832 SRR015435.35022 DB704106 SRR015435.259743 SRR015435.42815 SRR015435.46118 SRR015435.34522 AI775425 DB694674 DB715741 AI776219 SRR015435.27481 AI771240 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 9.A.5 Peroxisomal protein importer PPI |
| Probeset |
|
| Corresponding NCBI Gene | 834549 |
| Trichome-related Gene from Literature | 834549 |