| Detail of EST/Unigene TCSL72456 |
| Acc. | TCSL72456 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 946 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | |
| Sequence | GACAATATTTAATACCATAAAATACTCAACACTTTTCTCTTAATATAAATCATGGCAGCT |
| EST members of Unigene | BP896872 AI773467 BP905171 BG128891 BP898985 BP900916 BG124637 BG642708 BG128339 BP898629 BP906549 BP897666 BP899408 AI774078 AI781688 BP901151 AI482904 BG642879 BP907479 BP896986 BG127086 BP897575 BP907440 BP897980 BP909192 BP898376 BP900894 AW623947 BG127902 BP911333 SRR015435.189548 BG128490 BP902070 BP903615 AI778726 AI490205 BP897294 DB679049 BP899465 AW623677 BP903144 BP900052 BG126096 BP901989 AI772404 BP901027 BP901028 BP910687 BP910688 BG643768 AI490192 BG642806 BP898523 BP901423 BP882654 BP905639 BP896522 BG127670 BP907925 BP909860 BI933441 BP902139 BG643331 BP897698 CK715083 BG643341 CK715185 BI929653 BP900809 BG643347 BG129159 BP903697 AI779780 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |