Detail of EST/Unigene TCSL73801 |
Acc. | TCSL73801 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Dynamin-related protein 5A OS=Glycine max E-value=0; Dynamin-related protein 12A OS=Glycine max E-value=0; Dynamin-related protein 1A OS=Arabidopsis thaliana E-value=0; Dynamin-related protein 1B OS=Arabidopsis thaliana E-value=0; Dynamin-related protein 1E OS=Arabidopsis thaliana E-value=0; |
Length | 2230 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (12 ESTs); SRR015435 (7 ESTs); SL_breaker_fruit (5 ESTs); SL_MicroLEAF3 (5 ESTs); SL_flower_buds3 (4 ESTs); SL_TAMU (3 ESTs); SL_Lyc_leaf (3 ESTs); SL_TRI (2 ESTs); SL_flower_buds8 (2 ESTs); SL_FLOWER_DEV (2 ESTs); SL_FRUIT (1 ESTs); SL_CELL_BTI (1 ESTs); SL_SUS_LEAF (1 ESTs); SL_germ_seedlings_TAMU (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_maturing_fruit (1 ESTs); |
Sequence | AAAAGCTTTCTAATTTCAAAATCTTAGCTCTCTCTCTCACACACACACAAATTGCGAAAA |
EST members of Unigene | AI779478 BG629050 AI489758 SRR015435.333673 BM536046 AI483534 DB704149 SRR015436.198772 SRR015436.147314 BM536055 SRR015435.261180 BG629045 BP906675 DB687001 SRR015436.180127 BI926446 SRR015435.140226 BP907430 SRR015436.308166 BI926265 SRR015435.346107 ES892525 DB702198 AW217507 AW039289 SRR015436.4442 ES891637 BP910459 BP885346 BG123760 SRR015436.270651 AI489295 SRR015435.211211 AW648435 SRR015436.250454 SRR015435.292254 BI926436 AW622818 SRR015436.141872 BE436203 DB686425 BI924011 DB701258 SRR015436.59242 SRR015436.316028 BM536090 BF113371 SRR015436.95380 BM411131 SRR015436.6886 SRR015435.281657 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834213 |
Trichome-related Gene from Literature | 834213 |