Detail of EST/Unigene TCSL73864 |
Acc. | TCSL73864 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Sucrose transport protein OS=Spinacia oleracea E-value=0; Sucrose transport protein SUC2 OS=Arabidopsis thaliana E-value=0; Sucrose transport protein SUC1 OS=Arabidopsis thaliana E-value=0; Sucrose transport protein SUC5 OS=Arabidopsis thaliana E-value=0; Sucrose transport protein SUC8 OS=Arabidopsis thaliana E-value=0; |
Length | 2087 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (26 ESTs); SL_MicroLEAF3 (8 ESTs); SL_Lyc_leaf (4 ESTs); SL_CELL_BTI (4 ESTs); SL_FLOWERBUDS (4 ESTs); SL_germ_seedlings_TAMU (3 ESTs); SL_RES (2 ESTs); SL_TAMU (2 ESTs); SL_radicle (2 ESTs); SL_CDS (2 ESTs); SL_MicroFRUIT2 (1 ESTs); LIBEST_024457 (1 ESTs); SL_Seedlings (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_DROOT (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); SL_SUS_LEAF (1 ESTs); SL_maturing_fruit (1 ESTs); SRR015436 (1 ESTs); |
Sequence | CATTACGGCCGGGGATAACATTCAAAACCCAAAATTAAAACAGAGCAATTTTAGTTTCTT |
EST members of Unigene | SRR015435.137082 AW648904 SRR015435.238705 DB680726 SRR015435.352675 SRR015435.287732 DB697347 AW041493 SRR015435.53951 EG553097 AW647947 X82275 AW091664 SRR015435.79332 SRR015436.31731 DB693925 BW686320 AI896588 SRR015435.324208 AI782568 CK715174 BE353722 AI488770 AW738264 SRR015435.102257 BP907830 BP900295 DB690835 AW738465 BP898370 AW218180 AW218181 SRR015435.139266 SRR015435.118748 AI773547 AW738200 BP889410 DB682023 SRR015435.22979 SRR015435.181063 SRR015435.251194 DB692216 SRR015435.20439 GO374299 SRR015435.73819 SRR015435.5449 AW929861 BT012713 SRR015435.185170 AI775666 SRR015435.129259 SRR015435.166310 AW648649 DB692346 SRR015435.313061 SRR015435.94414 AW041163 SRR015435.304907 SRR015435.222332 SRR015435.93241 AI485383 SRR015435.357837 BP896152 DB702306 AW442640 SRR015435.290564 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 2.A.2 Glycoside/pentoside/hexuronide,cation symporter GPH |
Probeset |
|
Corresponding NCBI Gene | 838877 |
Trichome-related Gene from Literature | 838877 |