Detail of EST/Unigene TCSL74679 |
Acc. | TCSL74679 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Rhodospirillum centenum (strain ATCC 51521 / SW) E-value=0; |
Length | 1561 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_Lyc_leaf (7 ESTs); SRR015436 (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SRR015435 (1 ESTs); SL_flower_buds4 (1 ESTs); SL_maturing_fruit (1 ESTs); SL_FLOWERBUDS (1 ESTs); SL_RES (1 ESTs); SL_DEF_ROOT (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_FRUIT (1 ESTs); |
Sequence | TAAACGACAATAGACAAGTTTCTTTACCTACTGCTACTCTGGATGGGCCAGTTGCTCCTG |
EST members of Unigene | BI928215 BP905740 SRR015436.194304 BG642664 BP904947 AW222139 BE433488 BF097962 BE354356 BP909631 SRR015436.135332 BP907410 SRR015435.1752 BP909717 BP908170 BP881899 BG128401 AI774487 BP908309 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
EC | 2.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827230 |
Trichome-related Gene from Literature | 827230 |