Detail of EST/Unigene TCSL75943 |
Acc. | TCSL75943 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=0; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-92; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase OS=Protochlamydia amoebophila (strain UWE25) E-value=5e-52; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase OS=Chlamydia pneumoniae E-value=3e-41; 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase OS=Thermoanaerobacter tengcongensis (strain DSM 15242 / JCM 11007 / NBRC 100824 / MB4) E-value=4e-41; |
Length | 1194 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (24 ESTs); SRR015435 (22 ESTs); SL_TAMU_CALLUS (2 ESTs); SL_GFRUIT (1 ESTs); SL_maturing_fruit (1 ESTs); SL_flower_buds8 (1 ESTs); SL_RES (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_breaker_fruit (1 ESTs); SL_flowerbuds4 (1 ESTs); |
Sequence | GCAACAGCACCCCCAGCCATTACGGCCGGGGGAAGGATCAACTCCTCTATTTTCATTCAT |
EST members of Unigene | SRR015436.308929 SRR015435.61329 AI896422 SRR015435.118101 SRR015436.128545 SRR015435.107830 SRR015435.243343 SRR015435.244111 SRR015435.162256 SRR015435.273179 SRR015436.261449 AW622755 SRR015435.251881 SRR015435.153168 AW934532 SRR015436.325062 BE459505 AI774374 SRR015436.220319 BM408533 SRR015436.55788 SRR015435.172404 SRR015436.132121 SRR015435.287165 SRR015436.160316 SRR015436.188758 BP895152 SRR015436.45732 SRR015435.273355 SRR015436.155740 AW031901 SRR015435.319995 SRR015436.68880 SRR015436.142039 SRR015435.114702 SRR015435.168957 SRR015436.319222 SRR015436.309214 SRR015436.200383 SRR015436.237655 SRR015436.248471 SRR015436.330198 SRR015435.283956 SRR015435.323920 SRR015435.71563 SRR015435.236907 SRR015436.85804 SRR015436.312950 SRR015435.144007 SRR015436.299986 SRR015436.152717 SRR015435.326217 BG125674 SRR015436.139410 SRR015435.354548 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 814779 |
Trichome-related Gene from Literature | 814779 |