Detail of EST/Unigene TCSL76033 |
Acc. | TCSL76033 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 3-ketoacyl-CoA synthase 10 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 4 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 11 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 9 OS=Arabidopsis thaliana E-value=0; 3-ketoacyl-CoA synthase 17 OS=Arabidopsis thaliana E-value=0; |
Length | 1176 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015435 (11 ESTs); SRR015436 (11 ESTs); SL_flower_anthesis (2 ESTs); SL_MicroLEAF3 (2 ESTs); SL_flowerbuds4 (1 ESTs); SL_SUS_LEAF (1 ESTs); |
Sequence | CAATTACGTCTCAATCCCAATAATGGCTCGAGAAGAACATCTTCTATCAACGGAGATTGT |
EST members of Unigene | SRR015435.309223 SRR015435.320655 SRR015435.98696 SRR015435.135494 DB686101 SRR015435.355389 BI934336 SRR015436.207882 SRR015435.136513 SRR015436.215020 DB695070 SRR015436.310410 SRR015436.204163 SRR015436.272880 AW934652 SRR015435.80388 SRR015435.244010 SRR015435.212962 SRR015436.91635 SRR015436.280102 SRR015436.269161 SRR015435.57176 SRR015436.275196 AI780638 SRR015435.204844 BI933818 SRR015436.278448 SRR015436.218668 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817165 |
Trichome-related Gene from Literature | 817165 |